|
ATCC
human hct116 p53 proficient ![]() Human Hct116 P53 Proficient, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/HCT+116/pmc13061550-50-1-23 Average 99 stars, based on 1 article reviews
human hct116 p53 proficient - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Yeasen Biotechnology
human p53 r175h ![]() Human P53 R175h, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/inhibitor+p53/pm42273915-75-5-11 Average 86 stars, based on 1 article reviews
human p53 r175h - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Huabio Inc
antibodies mouse anti human p53 ![]() Antibodies Mouse Anti Human P53, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/anti+p53/pm42017307-68-14-18 Average 86 stars, based on 1 article reviews
antibodies mouse anti human p53 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex hp53 1 393 addgene 2486 ![]() Pgex Hp53 1 393 Addgene 2486, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/pGEX-human+p53-(1-393)+(Plasmid+%2324860)/pmc13039399-366-44-47 Average 93 stars, based on 1 article reviews
pgex hp53 1 393 addgene 2486 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
anti p53 ![]() Anti P53, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/Mouse+anti+Human+p53+(aa181-190)/pmc13130618-50-34-41 Average 93 stars, based on 1 article reviews
anti p53 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
mouse anti human p53 do 1 primary antibody ![]() Mouse Anti Human P53 Do 1 Primary Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/p53+Antibody/bio_rxiv__64898__2026__03__05__709702-293-5-11 Average 96 stars, based on 1 article reviews
mouse anti human p53 do 1 primary antibody - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
R&D Systems
anti acetylated p53 k382 ![]() Anti Acetylated P53 K382, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/Human+Acetylated+p53+(K382)+Antibody/pmc13028985-84-9-20 Average 94 stars, based on 1 article reviews
anti acetylated p53 k382 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
R&D Systems
anti phospho p53 ser15 ![]() Anti Phospho P53 Ser15, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+p53/Human+Phospho-p53+(S15)+Antibody/pm41688418-371-43-46 Average 93 stars, based on 1 article reviews
anti phospho p53 ser15 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Journal: Aging and Disease
Article Title: Anillin Recedes in p53-Dependent Senescence of Tumor Cells and Reappears in Cells Escaping from Senescence
doi: 10.14336/AD.2025.0402
Figure Lengend Snippet: Analysis of the selected senescence markers and anillin levels in HCT116 p53WT and MCF-7 cells induced to senesce by 1 day-treatment with doxorubicin and collected 5 days after senescence induction. ( A, B ) Densitometric analysis of protein levels in HCT116 p53WT ( A ) and MCF-7 ( B ), n=9; statistical analysis was performed using paired one-tailed t-Student test. Relative protein expression means fold change (in the expression of proteins relative to the expression of GAPDH) vs appropriate control. Boxes: Q1, median, Q3; error bars: Minimum, Maximum. ( C ) Representative images from Western blotting of HCT116 p53WT and MCF-7 cell lysates. ( D, E ) Analysis of fluorescence intensity of anillin (whole nucleus area) and representative images ( F, G ) of control and doxorubicin-treated HCT116 p53WT ( D, F ) and MCF-7 cells ( E, G ), n=3; statistical analysis was performed using Wilcoxon matched-pairs signed-rank test. Data on graphs represent individual values for analyzed cells, median, error bars: Minimum, Maximum. Red – anillin, blue – DAPI stained DNA. Scale 20 µm. Statistical significance relative to control: ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001
Article Snippet: The
Techniques: One-tailed Test, Expressing, Control, Western Blot, Fluorescence, Staining
Journal: Aging and Disease
Article Title: Anillin Recedes in p53-Dependent Senescence of Tumor Cells and Reappears in Cells Escaping from Senescence
doi: 10.14336/AD.2025.0402
Figure Lengend Snippet: Analysis of selected senescence markers and anillin levels in HCT 116 p53KO cells induced to senescence by doxorubicin treatment for 1 day and collected 5 days after senescence induction. ( A ) Densitometric analysis of protein levels in control and doxorubicin-treated HCT116 p53KO based on Western blotting results, n=8; statistical analysis was performed using paired one-tailed t-Student test. Statistical significance is shown relative to control. ( B ) Representative images from Western blotting. ( C ) Comparison of anillin and p53 levels in p53-proficient (HCT116 p53WT and MCF7) and p53-deficient (HCT116 p53KO) cells treated with doxorubicin and analyzed using Western blotting, densitometric analysis (normalized to the level of anillin or p53 in control cells), n=3; statistical analysis was performed using Kruskal-Wallis test. Statistical significance is shown for differences between indicated cell lines. Relative protein expression means fold change (in the expression of proteins relative to the expression of GAPDH) vs appropriate control. ( D ) Representative images of immunostained control and doxorubicin-treated HCT116 p53KO cells. Red – anillin, green – lamin A/C, blue – DAPI stained DNA. Scale 20 µm. Boxes: Q1, median, Q3; error bars: Minimum, Maximum. Statistical significance: **** p ≤ 0.0001
Article Snippet: The
Techniques: Control, Western Blot, One-tailed Test, Comparison, Expressing, Staining
Journal: Aging and Disease
Article Title: Anillin Recedes in p53-Dependent Senescence of Tumor Cells and Reappears in Cells Escaping from Senescence
doi: 10.14336/AD.2025.0402
Figure Lengend Snippet: Correlation between p53 and anillin levels during senescence and the escape from senescence in breast cancer MCF-7 and colon cancer HCT116 p53WT cells (see ). ( A-B ). Representative Western blots showing the levels of anillin and p53 in HCT116 p53WT cells ( A ) and MCF-7 cells ( B ). ( C-F ) The level of anillin and p53 on subsequent days of cell culture after senescence induction by doxorubicin in HCT116 p53WT ( C and E ) and MCF-7 cells ( D and F ) n = 4; statistical analysis was performed using one-way ANOVA followed by post hoc analysis (Tukey’s honest significant difference test; HSD test). Statistical significance of differences between indicated days of treatment: * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001. Boxes: Q1, median, Q3; error bars: Minimum, Maximum. ( G ) The heat map shows the levels of anillin and p53 during senescence and escape from senescence in MCF-7 and HCT116 p53WT cells. Heatmap: Original data points are standardized into z-scores.
Article Snippet: The
Techniques: Western Blot, Cell Culture
Journal: Aging and Disease
Article Title: Anillin Recedes in p53-Dependent Senescence of Tumor Cells and Reappears in Cells Escaping from Senescence
doi: 10.14336/AD.2025.0402
Figure Lengend Snippet: Inverse correlation between ANLN and p53 during senescence and escape from senescence in cancer cells. Downregulation of anillin is a consequence of the induction of p53 due to cellular senescence. After some time, senescent cells resume divisions, which is associated with a decrease in p53 levels and an increase in anillin. Performed with Biorender.
Article Snippet: The
Techniques:
Journal: Cell Death & Disease
Article Title: Transcription-dependent and -independent functions of Drosophila p53 isoforms in the induction of apoptosis and senescence-associated tumorigenesis
doi: 10.1038/s41419-026-08571-x
Figure Lengend Snippet: A Wing imaginal discs expressing the corresponding UAS transgenes under the sal> driver. When indicated the expression of the hp53 was performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue), Myc (white, only when indicated) and Dcp1 (red). A dotted green line marks the sal domain. Scale bar is 50 μm. B Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( A ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 by one-way ANOVA. C Wing imaginal discs expressing UAS- hp53 in different conditions of cell cycle arrest stained for GFP (green), DAPI (blue) and Dcp1 (red). D Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( C ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and ** P value < 0.001 by one-way ANOVA. E Wing imaginal discs expressing the Dronc activity sensor under the sal> driver and the corresponding transgenes. The imaginal discs were stained for GFP (green), Myc (red) and DAPI (blue). A dotted red line marks the sal domain delimited by Myc staining. The scale bar is 50 μm. F Quantification of GFP (Dronc activity) in the sal domain of wing imaginal discs from the genotypes presented in ( E ). Error bars indicate SEM. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. **** P value < 0.0001 by one-way ANOVA. G Wing imaginal discs expressing UAS- hp53 ΔDBD with the sal > GFP driver in a wildtype, dronc and p53 mutant backgrounds stained for GFP (green), DAPI (blue) and Dcp1 (red). A dotted green line marks the sal domain. The scale bar is 50 μm. H Quantification of Dcp1 staining in the sal domain of wing imaginal discs from the genotypes presented in ( G ). The data are derived from three independent biological replicates, analyzing more than 15 discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and *** P value < 0.005 by one-way ANOVA.
Article Snippet: When ligated, the N and C-terminus of p53 maintain the ORF. p53-B-N-terminal forward: CAGTGAATTCATGAGTCTTCACAAGTCCGC (EcoR1) p53-B-N-terminal reverse: CAGTAGATCTCTAGCTTGGGCAGCGTGTTCGCC (BglII) p53-B-C-terminal forward: CAGTAGATCTATAGCAAGAAGCGCAAGTCCGTGCC (BglII) p53-B-C-terminal reverse: CAGTGAATTCTGGCAGCTCGTAGGCACGTTTC (EcoR1) UAS- hp53-6xMyc : The coding region of the full length human p53 was PCR amplified from the
Techniques: Expressing, Mutagenesis, Staining, Derivative Assay, Activity Assay
Journal: Cell Death & Disease
Article Title: Transcription-dependent and -independent functions of Drosophila p53 isoforms in the induction of apoptosis and senescence-associated tumorigenesis
doi: 10.1038/s41419-026-08571-x
Figure Lengend Snippet: A Wing imaginal discs expressing hp53 with the nub> driver. When indicated the expression of hp53 was combined with the UAS- miRHG or performed in a dronc mutant background. Imaginal discs were stained for GFP (green), DAPI (blue) and Dcp1 (white). A dotted green line marks the nub domain. The scale bar is 50 μm. B Quantification of the tumor overgrowths from the genotypes indicated in ( A ), calculated as a percentage of the nub domain. The data are derived from three independent biological replicates, analyzing more than ten discs per genotype. Error bars indicate SEM. **** P value < 0.0001 and not significant (ns) P value > 0.05 by one-way ANOVA. C , D Representative wildtype wing imaginal disc and disc expressing hp53 in a dronc mutant background ( n > 10) stained for GFP (green), DAPI (blue), MMP1 (red) and pH3 (white) in ( C ) or GFP (green), DAPI (blue) and EdU (white). A dotted green line marks the nub domain. Scale bar is 50 μm.
Article Snippet: When ligated, the N and C-terminus of p53 maintain the ORF. p53-B-N-terminal forward: CAGTGAATTCATGAGTCTTCACAAGTCCGC (EcoR1) p53-B-N-terminal reverse: CAGTAGATCTCTAGCTTGGGCAGCGTGTTCGCC (BglII) p53-B-C-terminal forward: CAGTAGATCTATAGCAAGAAGCGCAAGTCCGTGCC (BglII) p53-B-C-terminal reverse: CAGTGAATTCTGGCAGCTCGTAGGCACGTTTC (EcoR1) UAS- hp53-6xMyc : The coding region of the full length human p53 was PCR amplified from the
Techniques: Expressing, Mutagenesis, Staining, Derivative Assay
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Moderate regulation of alternatively spliced p53β mRNA by UPF1. A Alternative splicing (AS) and nonsense-mediated decay (NMD) involving exon 9b (E9b) within p53 intron 9. Inclusion or skipping of E9b (dark gray box) generates p53β or p53α mRNA, respectively. E9b is expected to recruit UPF1 and can be degraded. B UV-crosslinking RNA immunoprecipitation (UV-RIP) assays. HeLa cells were cotransfected with Flag-UPF1 and Dup-p53 minigenes. Lysates were immunoprecipitated using anti-Flag M2 agarose beads. Enrichment of the E9b-included isoform (Dup-β) was assessed using primers spanning the E9b–β-globin exon 2 junction of p53. Data are represented as mean ± SEM (n ≥ 3). * p < 0.05. C Splicing analysis of Dup-p53 minigene-transfected HeLa cells. STOP and GO reporters were used for NMD analysis with or without a premature termination codon (PTC). Primers targeting β-globin exon 1 (forward) and exon 2 (reverse) were used. The upper band corresponds to the E9b-included isoform (β), and the lower band to the E9b-skipped isoform (α). β-actin serves as a loading control. D Splicing analysis from Dup-p53 (STOP) minigene in siUPF1-transfected HeLa cells compared with siGFP-transfected control cells. The upper band corresponds to the E9b-included isoform (β), and the lower band to the E9b-skipped isoform (α). RT-PCR was performed employing β-globin exon 1 (forward) and exon 2 (reverse) primers. UPF1 knockdown was confirmed by Western blot assays (bottom). β-actin was used as a loading control. E RT-qPCR analysis for endogenous p53 mRNA isoforms—p53α and p53β—in UPF1-depleted HeLa cells. F RT-qPCR analysis for exon 1 of endogenous p53 in UPF1-depleted HeLa cells, corresponding to the 5′ UTR. (G, H) Decay rates of p53α mRNA G and p53β mRNA H in siUPF1- and siGFP-transfected cells following transcription inhibition using actinomycin D (ActD). The mean half-lives of p53α or p53β mRNAs are indicated by a dashed line. Data are represented as mean ± SEM (n ≥ 3)
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Alternative Splicing, RNA Immunoprecipitation, Immunoprecipitation, Transfection, Control, Reverse Transcription Polymerase Chain Reaction, Knockdown, Western Blot, Quantitative RT-PCR, Inhibition
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Identification and localization of the intron-retained p53 transcript. A Diagram of sequential (seq) or non-sequential (non-seq) splicing of p53 intron 9. I9a and I9b indicate the upstream and downstream introns flanking E9b, respectively. Predicted premature termination codons (PTCs) are shown in red. B RT-qPCR analysis of intron retention in p53 transcripts under basal conditions in HeLa cells. I2, intron2; N.D., not detected. C Decay rates of p53-IR transcript in siUPF1- and siGFP-transfected HeLa cells following transcription inhibition with ActD. The mean half-lives of p53-IR transcript are indicated by a dashed line. Data are represented as mean ± SEM (n ≥ 3). D RT-qPCR-based quantification of p53α, p53β, and p53-IR transcript following cycloheximide (CHX) treatment in HeLa cells. Data are represented as mean ± SEM (n ≥ 3). ** p < 0.01. E , F Ratios of p53α, p53β, and p53-IR transcript levels altered by CHX treatment in the nuclear and cytoplasmic fractions of HeLa cells, compared with DMSO-treated controls. Data are presented as mean ± SEM (n ≥ 3). *** p < 0.001. G Subcellular localization of p53 transcripts in HeLa cells. Cytoplasmic (Cy), Nucleoplasmic (Np), and chromatin-associated (Chr) fractions are indicated. GAPDH pre-mRNA and NEAT1 long noncoding RNA were used as nuclear-retained RNA markers, and 18S ribosomal RNA was used as a cytoplasmic RNA marker
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Quantitative RT-PCR, Transfection, Inhibition, Marker
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Chromatin association of SRSF3 and UPF1 at the TP53 gene. A Subcellular localization of SRSF3 and UPF1 in HeLa cells. α-tubulin and Histone H3 are markers for the cytoplasmic and chromatin-associated fractions, respectively. Regarding SRSF1, hyperphosphorylated forms localize to the nucleoplasm, while hyperphosphorylated forms localize to the cytoplasm. B UPF1 and SRSF3 chromatin immunoprecipitation (ChIP) analysis of TP53 genomic regions. UPF1 ChIP was performed using an anti-UPF1 antibody compared with an anti-IgG control in HeLa cells, whereas SRSF3 ChIP was performed using an anti-Flag antibody in Flag-SRSF3-expressing HeLa cells compared with Flag-empty vector (Flag-Vec) control cells. Pro, promoter; I4, intron 4; I9, intron 9; E11, exon 11. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05; ** p < 0.01. C Coimmunoprecipitation (co-IP) showing the interaction between UPF1 and SRSF3. HeLa cells were cotransfected with Myc-UPF1 and Flag-SRSF3, and immunoprecipitation was performed utilizing anti-Flag antibody. D Coimmunofluorescence (co-IF) of UPF1 and SRSF3 after treatment with transcription or translation inhibitors, which are actinomycin D (ActD) and flavopiridol (Flavo), or cycloheximide (CHX), respectively. UPF1 was detected using Cy3-conjugated secondary antibody (red), and SRSF3 was identified employing the Alexa Fluor 488-conjugated one (green). Nuclei were counterstained with DAPI (blue). Scale bars, 5 μm. E Quantification of UPF1 and SRSF3 colocalization by Pearson’s correlation coefficient. Data are presented as mean ± SEM (n ≥ 30). *** p < 0.001. F Representative images of in situ proximity ligation assay (PLA) between UPF1 and SRSF3 in HeLa cells. Each cell was treated with DMSO (control), ActD, Flavo, or CHX. PLA signals are shown as red puncta, and nuclei are counterstained with DAPI (blue). Scale bars, 5 μm. G Quantification of the mean of nuclear PLA signals per nucleus. Data are presented as mean ± SEM (n ≥ 30). Statistical significance was determined by one-way ANOVA. * p < 0.05; *** p < 0.001
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Chromatin Immunoprecipitation, Control, Expressing, Plasmid Preparation, Co-Immunoprecipitation Assay, Immunoprecipitation, In Situ, Proximity Ligation Assay
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Binding of SRSF3 at the retained intron of p53 transcript. A UV-RNA immunoprecipitation (UV-RIP) analysis of endogenous p53 (pre-)mRNA. Flag-SRSF3-expressing and Flag-Vec control cells were subjected to immunoprecipitation using an anti-Flag antibody. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05; ** p < 0.01. B Schematic diagram of Dup-p53 minigene reporters harboring mutations in SRSF3-binding motifs, indicated by black circles, and mutated motifs by white circles. The WT contains all intact SRSF3-binding motifs. Mutant reporters (Mut1–Mut4) contain individual or combinations of mutated SRSF3-binding motifs, as indicated. C UV-RIP analysis of Dup-p53 minigene reporters. Flag-SRSF3-expressing cells and Flag-Vec control cells were subjected to immunoprecipitation using an anti-Flag antibody. Data are presented as mean ± SEM (n ≥ 3). ** p < 0.01. D Splicing analysis of Dup-p53 minigene reporters in transfected HeLa cells. Relative Dup-β transcript level was measured by RT-qPCR. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05. E SRSF3 tethering analysis in combination with UPF1 knockdown. MS2 RNA hairpins were inserted into I9a of the Dup-p53 minigene, and MS2-binding protein (MBP)-fused SRSF3 was co-transfected to tether SRSF3 to the MS2 RNA. RT-qPCR was used to quantify Dup-α and Dup-β isoforms. Data are presented as mean ± SEM (n ≥ 3). ** p < 0.01. F Proposed model illustrating the splicing-linked RNA surveillance mechanism. p53-IR transcript interacts with SRSF3, which subsequently recruits UPF1. Formation of p53-IR–SRSF3–UPF1 ternary complex suppresses E9b inclusion, thereby preventing production of the p53β mRNA
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Binding Assay, RNA Immunoprecipitation, Expressing, Control, Immunoprecipitation, Mutagenesis, Transfection, Quantitative RT-PCR, Knockdown
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Expression of C-terminal truncated p53 protein upon SRSF3 depletion. A RT-qPCR analysis of p53α and p53β mRNA levels in HEK293, HeLa, HCT116, and SW480 cells transfected with siRNA targeted to SRSF3 (siSRSF3) compared to control siRNA (siGFP). Exon junction-specific primers used for isoform detection are shown (left). Data are presented as mean ± SEM (n ≥ 3). * p < 0.05; ** p < 0.01. B Western blot analysis of p53 protein isoforms in SW480 cells transfected with siRNAs targeting SRSF3 and SRSF1. p53 isoforms were detected using anti-p53 (DO-1) antibody. The upper band corresponds to p53α protein (~ 53 kDa), and the lower band to p53β protein isoform (~ 47 kDa). β-actin serves as a loading control. C Western blot analysis of p53 protein isoforms in SRSF3 knockout (KO) SW480 cells obtained by employing CRISPR/Cas9. Total cell lysates were analyzed using anti-p53 (Pab1801 and DO-11) and a custom anti-p53β-specific antibody. β-actin serves as a loading control. D Western blot analysis of p53 protein isoforms in UPF1-depleted SW480 cells (siUPF1) compared to control cells (siGFP). The anti-p53 (DO-1) antibody used in (B) was also employed to detect p53α and p53β protein isoforms. β-actin serves as a loading control. E Quantification of p53α and p53β protein isoform levels detected by anti-p53 (DO-11) antibody. Data are presented as mean ± SEM (n = 3). ** p < 0.01. F Proposed model explaining the production of the C-terminal truncated p53β protein isoform
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Expressing, Quantitative RT-PCR, Transfection, Control, Western Blot, Knock-Out, CRISPR
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Oncogenic functions of the C-terminal truncated p53β protein isoform. A Cell morphology of colorectal cancer cell lines (HCT116 WT and HCT116 p53−/− , DLD-1) and a lung cancer cell line (A549) upon Flag-p53β overexpression. B RT-qPCR analysis of EMT markers, ZEB1 and TWIST mRNAs, in stably Flag-p53β- expressing HCT116 WT and HCT116 p53−/− , and A549 cells. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05; ** p < 0.01. C , D Wound closure assay in stably Flag-p53β-expressing HCT116 WT and HCT116 p53−/− , and A549 cells. Wound closure was measured 48 h after scratching. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05. E , F Matrigel invasion assay using stably Flag-p53β-expressing HCT116 WT and HCT116. p53−/− , and A549 cells. Cells were seeded in the upper chamber of Matrigel-coated transwells. Invaded cells on the bottom surface were counted after 48 h. Data are presented as mean ± SEM (n ≥ 3). * p < 0.05; *** p < 0.001
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Over Expression, Quantitative RT-PCR, Stable Transfection, Expressing, Wound Closure Assay, Invasion Assay
Journal: Cell & Bioscience
Article Title: Regulation of oncogenic C-terminal truncated p53β protein isoform expression by SRSF3–UPF1 splicing and surveillance axis
doi: 10.1186/s13578-026-01556-5
Figure Lengend Snippet: Biogenesis of p53 mRNAs and functions of p53 protein isoforms. The scheme represents the role of a newly identified intron-retained p53 transcript (p53-IR transcript) in preventing the generation of the C-terminal truncated and pro-metastatic p53β protein. During transcription elongation, SRSF3 associates with the p53-IR transcript and recruits UPF1 forming a transcript surveillance complex. It specifically monitors p53 pre-mRNA and suppress p53β mRNA expression and C-terminal-truncated p53β protein, which promote epithelial–mesenchymal transition (EMT) and metastasis
Article Snippet: The antibodies used were as follows- anti-UPF1 (Cell Signaling, #12,040), anti-SRSF3 (Invitrogen, #33–4200), anti-FLAG-M2 (Sigma, #F3165), anti-SRSF1 (Thermo Fisher, #32–4500), anti-Histone H3 (Abcam, #ab1791), anti-α-tubulin (Santa Cruz, #sc-8035), anti-β-actin (Abcam, #ab6276), anti-Myc (Sigma, #05-724MG),
Techniques: Expressing
Journal: bioRxiv
Article Title: Multi-omics and functional analysis of a bioengineered vascularized pancreatic cancer model reveal an immunosuppressive and therapy-resistant niche
doi: 10.64898/2026.03.05.709702
Figure Lengend Snippet: ( A ) Gene ontology enrichment analysis of epithelial clusters (Epi1–Epi5, EMT) using upregulated genes (Log2(FC) > 0.5, adj. p-value > 0.05). Top: Bubble plots showing significant enriched pathways and biological processes, with color intensity representing q-values and bubble size representing the gene ratio (%). Bottom: Schematic representation of the top expressed genes and associated pathways for each cluster. ( B ) Spatial transcriptomic mapping of representative biological pathways across vascularized spheroid sections, illustrating enrichment of negative ferroptosis regulation, G2/M checkpoint activity, IFN-α response, p53 signaling, and EMT programs. ( C ) Schematic of spheroid cultured for 7 days in 3D within the hydrogel region of the OrganiX TM inserts (left), and representative confocal images of C and CSEM spheroid models showing immunofluorescence validation of p53 expression (green: PANC-1; red: p53; blue: DRAQ7 nuclear stain). Scale bar: 200µm. Schematics created in BioRender.com. ( D ) Spatial visualization of p53 transcriptional signature in the CSEM spheroids. Color scale indicates module score for the mentioned gene set. ( E ) Spatial distribution of gene expression for the most significantly enriched biological process of each epithelial cell cluster in vascularized quadri-culture spheroids. Color scale indicates module score for the mentioned gene set.
Article Snippet: Upon washing, overnight incubation with
Techniques: Activity Assay, Cell Culture, Immunofluorescence, Biomarker Discovery, Expressing, Staining, Gene Expression
Journal: Pathogens
Article Title: The SIRT1-Mediated p53 Deacetylation Pathway Modulates Apoptosis and Promotes Viral Replication in MVC-Infected Cells
doi: 10.3390/pathogens15030242
Figure Lengend Snippet: MVC infection induces SIRT1 transcription and protein expression while modulating p53 acetylation. ( A , B ) Relative mRNA expression levels of SIRT1 and p53 in WRD cells at the indicated time points (6–60 h) following MVC infection (MOI = 2). SIRT1 and p53 mRNA levels were quantified by means of RT-qPCR and normalized to GAPDH. ( C ) Western blot analysis of SIRT1, p53, acetylated p53 (Ace-p53), NS1, and VP2 in WRD cells at 6–60 h following MVC infection (MOI = 2). GAPDH was used as a loading control in all experiments. The relative expression of SIRT1, Ace-p53, and total p53 protein was determined by means of densitometric quantification, as shown on the right, and data are shown as averages and standard deviations from 3 independent experiments in each panel. * p < 0.05; ** p < 0.01; ns: not significant.
Article Snippet: Primary antibodies employed for Western blotting are listed below:
Techniques: Infection, Expressing, Quantitative RT-PCR, Western Blot, Control
Journal: Pathogens
Article Title: The SIRT1-Mediated p53 Deacetylation Pathway Modulates Apoptosis and Promotes Viral Replication in MVC-Infected Cells
doi: 10.3390/pathogens15030242
Figure Lengend Snippet: Immunofluorescence analysis of SIRT1 expression and its interaction with p53. ( A ) Subcellular localization of SIRT1 and MVC-VP2. WRD cells were subjected to mock infection or MVC infection at an MOI of 2, followed by immunostaining with anti-SIRT1 antibody (green), anti-VP2 antibody (red, as an indicator of MVC infection), and 4′,6-diamidino-2-phenylindole (DAPI, blue, for nuclear counterstaining) at 24 and 48 hpi. ( B , C ) Verification of the interaction between SIRT1 and p53 was performed by means of co-immunoprecipitation (Co-IP) assay. ( B ) COS-1 cells were transfected with pCMV-HA-SIRT1 and pCMV-Myc-p53 expression plasmids for 48 h. Total cellular lysates were prepared and subjected to immunoprecipitation (IP) with 3 μg anti-HA antibody or 3 μg rabbit IgG (isotype control). The immunoprecipitates and input lysates were analyzed by means of Western blotting (WB) using anti-Myc antibody. ( C ) Reciprocal Co-IP assay: total lysates from transfected COS-1 cells were immunoprecipitated with 3 μg anti-Myc antibody or 3 μg mouse IgG (isotype control), followed by WB detection with anti-HA antibody. ( D ) Colocalization of SIRT1 and p53 in transfected COS-1 cells. COS-1 cells were co-transfected with pCMV-HA-SIRT1 and pCMV-Myc-p53 plasmids for 48 h; the cells were fixed, permeabilized, and subjected to immunofluorescence (IF) staining. HA-SIRT1 was probed with anti-HA antibody and visualized with Alexa Fluor 594-conjugated secondary antibody (red), Myc-p53 with anti-Myc antibody, and Alexa Fluor 488-conjugated secondary antibody (green), and cell nuclei were counterstained with DAPI (blue). Images were acquired using a confocal laser scanning microscope (CLSM). ( E ) Immunofluorescence staining showing the overlap of endogenous SIRT1 and p53. WRD cells were infected with MVC for 48 h, then fixed, permeabilized, and subjected to IF staining with anti-SIRT1 antibody (red fluorescence) and anti-p53 antibody (green fluorescence); nuclei were counterstained with DAPI (blue). Colocalization signals were observed using a CLSM. Scale bars: 10 μm. Values represent the mean ± SD from three independent experiments. Comparisons were performed using Student’s t -tests. * p < 0.05. For colocalization analysis, Pearson’s correlation coefficient and overlap coefficient were calculated (shown on the right of each panel). ns: not significant.
Article Snippet: Primary antibodies employed for Western blotting are listed below:
Techniques: Immunofluorescence, Expressing, Infection, Immunostaining, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Control, Western Blot, Staining, Laser-Scanning Microscopy, Fluorescence
Journal: Pathogens
Article Title: The SIRT1-Mediated p53 Deacetylation Pathway Modulates Apoptosis and Promotes Viral Replication in MVC-Infected Cells
doi: 10.3390/pathogens15030242
Figure Lengend Snippet: Effects of SIRT1 activation and inhibition on apoptosis-related molecules and viral production. MVC-infected cells were treated with resveratrol or Ex527, with untreated infected cells as the control. ( A , B ) RT-qPCR was performed to assess p53 mRNA expression in MVC-infected cells with treatment of 20 μM resveratrol ( A ) or 50 μM Ex527 ( B ). ( C , D ) Western blot analysis was conducted to examine the expression of apoptosis-related molecules in WRD cells infected by MVC following treatment with resveratrol ( C ) or Ex527 ( D ). Densitometric quantification of the indicated band intensities is presented on the right, with protein levels normalized to GAPDH. ( E , F ) Viral production was evaluated by quantifying intracellular ( E ) and extracellular ( F ) viral loads using absolute qPCR. Data are shown as means ± standard deviations from 3 independent experiments. Statistical significance was determined using Student’s t -test. * p < 0.05; ** p < 0.01; ns: not significant.
Article Snippet: Primary antibodies employed for Western blotting are listed below:
Techniques: Activation Assay, Inhibition, Infection, Control, Quantitative RT-PCR, Expressing, Western Blot
Journal: Pathogens
Article Title: The SIRT1-Mediated p53 Deacetylation Pathway Modulates Apoptosis and Promotes Viral Replication in MVC-Infected Cells
doi: 10.3390/pathogens15030242
Figure Lengend Snippet: Knockdown of SIRT1 alleviates MVC-induced S-phase arrest and enhances apoptotic cell death, consequently restricting viral propagation. ( A ) SIRT1 depletion decreased MVC-induced S-phase arrest. WRD cells stably expressing control shRNA or SIRT1-targeting shRNA were infected with MVC and subjected to cell cycle analysis by means of PI staining and flow cytometry at 24 hpi. The right panel shows quantification of cell cycle phases. Blue columns show the relative abundance of cells in S phase, with corresponding statistical analysis of S phase distribution. ( B ) SIRT1 silencing enhanced MVC-triggered apoptosis. WRD cells transfected with control siRNA or SIRT1 siRNA for 48 h were infected with MVC (MOI = 2) for an additional 48 h, apoptotic fractions were quantified by means of Annexin-V/PI flow cytometry. ( C ) SIRT1 knockdown upregulated p53 transcript abundance in MVC-infected cells. Total RNA was harvested and analyzed by means of qRT–PCR. ( D ) Impact of SIRT1 depletion on apoptosis-associated proteins. Whole-cell lysates prepared at 24 hpi were immunoblotted for Ace-p53, p53, Cleaved caspase 3, Bax, Bcl-2, p21, and GAPDH (loading control). ( E ) Intracellular virion DNA was diminished upon SIRT1 knockdown. Hirt DNA extracted from control shRNA- or SIRT1-specific shRNA-expressing cells at 24 hpi was detected by means of absolute quantitative real-time PCR using MVC-specific primers, and genome copy numbers were calculated against a standard curve. ( F ) Knockdown of SIRT1 reduced the release of progeny virions. Extracellular virions in clarified culture supernatants collected at 24 hpi were diluted and quantified by means of absolute qPCR. Data are shown as means ± standard deviations from 3 independent experiments. p values were determined using Student’s t -test. * p < 0.05; ** p < 0.01; ns: not significant.
Article Snippet: Primary antibodies employed for Western blotting are listed below:
Techniques: Knockdown, Stable Transfection, Expressing, Control, shRNA, Infection, Cell Cycle Assay, Staining, Flow Cytometry, Transfection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction
Journal: Pathogens
Article Title: The SIRT1-Mediated p53 Deacetylation Pathway Modulates Apoptosis and Promotes Viral Replication in MVC-Infected Cells
doi: 10.3390/pathogens15030242
Figure Lengend Snippet: Overexpression of SIRT1 enforces S-phase arrest, reduces apoptotic proteins, and promotes MVC replication. ( A ) SIRT1 overexpression promoted S-phase arrest. WRD cells transduced with lentiviruses containing the SIRT1 overexpressing vector or empty vector were infected with MVC (MOI = 2) and analyzed by means of PI staining and flow cytometry at 48 hpi. Representative histograms from three independent experiments are shown, with corresponding quantification of cell cycle phases on the right. Blue columns represent S phase cell proportions, and statistical analysis of S phase distribution is displayed. ( B ) RT-PCR analysis of p53 mRNA expression in SIRT1-overexpressing cells and control cells. ( C ) Western blot analysis of apoptotic proteins in cells transduced with the SIRT1 overexpressing vector or empty vector. Cell lysates were prepared at 48 hpi and immunoblotted for Ace-p53, p53, Bax, Bcl-2, Cleaved caspase 3, p21, and GAPDH (loading control). ( D ) SIRT1 overexpression elevated intracellular viral particles. Hirt DNA was extracted at 48 hpi and determined by means of absolute qPCR; the viral DNA copies were calculated using a standard curve. ( E ) SIRT1 overexpression boosted the release of viral progeny in the culture medium. The clarified supernatants collected at 48 hpi were diluted and quantified by means of absolute qPCR. Data are shown as means ± standard deviations from 3 independent experiments. p values were determined using Student’s t -test. * p < 0.05; ** p < 0.01; ns: not significant.
Article Snippet: Primary antibodies employed for Western blotting are listed below:
Techniques: Over Expression, Transduction, Plasmid Preparation, Infection, Staining, Flow Cytometry, Reverse Transcription Polymerase Chain Reaction, Expressing, Control, Western Blot